Review



corest protein  (BPS Bioscience)


Bioz Verified Symbol BPS Bioscience is a verified supplier
Bioz Manufacturer Symbol BPS Bioscience manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    BPS Bioscience corest protein
    Corest Protein, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/corest+protein/pmc06429430__cn8b00620_si_001-157-2-4?v=BPS+Bioscience
    Average 90 stars, based on 3 article reviews
    corest protein - by Bioz Stars, 2026-07
    90/100 stars

    Images



    Similar Products

    90
    Eurofins Genomics 50 primer for cloning corest (aa 86) protein into pleics12 vector: gtattttcagggcgccatgtg ggaggaaggcagc
    50 Primer For Cloning Corest (Aa 86) Protein Into Pleics12 Vector: Gtattttcagggcgccatgtg Ggaggaaggcagc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/corest+protein/pmc07043024__mmc2-226-77-79?v=Eurofins+Genomics
    Average 90 stars, based on 1 article reviews
    50 primer for cloning corest (aa 86) protein into pleics12 vector: gtattttcagggcgccatgtg ggaggaaggcagc - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Eurofins Genomics 30 primer for cloning corest protein (aa 485) into pleics12 vector: gacggagctcgaatttcagg aggcagatgcatatct
    30 Primer For Cloning Corest Protein (Aa 485) Into Pleics12 Vector: Gacggagctcgaatttcagg Aggcagatgcatatct, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/corest+protein/pmc07043024__mmc2-226-93-95?v=Eurofins+Genomics
    Average 90 stars, based on 1 article reviews
    30 primer for cloning corest protein (aa 485) into pleics12 vector: gacggagctcgaatttcagg aggcagatgcatatct - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    BPS Bioscience corest protein
    Corest Protein, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/corest+protein/pmc06429430__cn8b00620_si_001-157-2-4?v=BPS+Bioscience
    Average 90 stars, based on 1 article reviews
    corest protein - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    NeuroMab corest recombinant fusion protein to a region of human co-rest
    Antibodies used in this study
    Corest Recombinant Fusion Protein To A Region Of Human Co Rest, supplied by NeuroMab, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/corest+protein/pmc05805153-99-108-110?v=NeuroMab
    Average 90 stars, based on 1 article reviews
    corest recombinant fusion protein to a region of human co-rest - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Millipore corest protein
    Antibodies used in this study
    Corest Protein, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/corest+protein/pmc03498952-63-21-22?v=Millipore
    Average 90 stars, based on 1 article reviews
    corest protein - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    Image Search Results


    Antibodies used in this study

    Journal: The Journal of comparative neurology

    Article Title: Dissecting LSD1-Dependent Neuronal Maturation in the Olfactory Epithelium

    doi: 10.1002/cne.24259

    Figure Lengend Snippet: Antibodies used in this study

    Article Snippet: Information on the antibodies is derived from the manufacturers’ description, the literature, and our own data. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primary Antibody Immunogen Source, species, clonality, catalog#, RRID Dilution, staining protocol beta-actin Beta-actin N-terminal peptide ThermoFisher, mouse monoclonal, cat # MA5–15739 (clone BA3R), RRID: AB_10979409 1:1,000 for Western blot beta-gal Bacterial beta-galactosidase Abcam, chicken polyclonal, cat # ab9361, RRID: AB_307210 1:750 directly conjugated (5 min trypsin digest) CK14 Recombinant human KRT14 Proteintech, rabbit polyclonal, cat # 10143–1-AP, RRID: AB_2134831 1:1,000 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) CoREST Recombinant fusion protein to a region of human Co-REST NeuroMab, Mouse monoclonal, cat#75–039 (clone K72/8), RRID: AB_2301051 1:500 TSA (5 min 3% H 2 O 2 in methanol +10 min steam) GAP43 Synthetic peptide corresponding to residues on the C-terminus of human GAP43 Abcam, rabbit monoclonal, cat #ab75810, RRID: AB_1310252 1:1,000 TSA (5 min 3% H 2 O 2 in methanol) GFP Recombinant full length protein Abcam, chicken polyclonal, cat #ab13970, RRID: AB_300798 1:250 directly conjugated (tertiary for M72-GFP only) HDAC2 Synthetic peptide corresponding to amino acids 417–488 of human HDAC2 Abcam, mouse monoclonal, cat #ab12169, RRID: AB_2118547 1:100 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) LSD1 Synthetic peptide corresponding to Human KDM1/LSD1 aa 50–150 Abcam, rabbit monoclonal, cat #ab129195, RRID: AB_11145494 1:20,000 TSA (5 min 3% H 2 O 2 in methanol +10 min steam) OMP Synthetic peptide mapping within an internal region of human OMP Santa Cruz Biotechnology Inc, goat polyclonal, cat# sc-49070, RRID: AB_2158008 1:200 directly conjugated in steamed tissue, and 1:200 with TSA in non-steamed tissue MOR28 MOR28 extracellular epitope (amino acids 167–182) Gilad Barnea PhD Brown University, rabbit polyclonal, RRID: AB_2636804 1:5000 tertiary (5 min 3% H 2 0 2 in methanol +10 min steam) TdT Recombinant fusion protein to full length aa sequence from the mush-room polyp coral Discosoma Rockland Antibodies, rabbit polyclonal, cat #600–401-379, RRID: AB_2209751 1:200 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) Tuj1 Rat brain microtubules BioLegend, mouse monoclonal, cat # 801202 (clone TUJ1), RRID: AB_10063408 1:200 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) Open in a separate window Antibodies used in this study Anti-β-actin from ThermoFisher was used for a loading control in Western blots.

    Techniques: Staining, Western Blot, Recombinant, Serial Time-encoded Amplified Microscopy, Sequencing